SimpleSearch - Line and FST details


Line specific information

 
Line ID 763F07
Vector Used pGABI1
Line Availability only available from NASC (N473219)
Segregation Analysis 50:50:32
Confirmed for Hit At5g43650
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g43650

 
Sequence (A. th genome BLAST matches underlined)
>54-K023869-022-763-F07-8409
ATTGAATATCAATTGTAATGAGACATTGTAGATTTTAAGAAATGTAGATTTCACTCATTT
CATCATGACCATCCTTTGCTGATTTTTCCTCCATCACTTTAATTCCTCCCACTAGTTCTT
TCCTTAATCTTTGTAATTTCGCAATCTCATCCACGGCTTTTTCGACAATCGAATTTTTGT
CATTCTGAAATAAAATGAGAATATAAGGAGAAATGATGGTCTTGAAACTTGTTTCGATAT
CAATCTATGATGTTCTTTAAACTTGTTTCCATATCAAAATCCTTAAGTAAAAGAAAATAG
TGATAAAAGAAAAGATTCCAGTGCAAAAACTTACAAACATTTTATACAAATGATTGTAGT
TGGAAATTTATCATACTCAAAACTTTATATTATACCTTACTCAATATAAATTTATAGATA
TTTAAGATAAGCTTCTAAAACCAGATCAATGCATGTAATTAAGCATACAAACATCAAAGA
TCAGTGAACAGACATAGTAGTCGAAATTCTGAAAATTTAGTATCCATGA
GenBank Accession BX896949 [GenBank]
Graphic View Graphic view of gene At5g43650
Predicted Position of Insertion Chr5:17533752 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) K9D7
Hit Gene Code At5g43650 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic helix-loop-helix (bHLH) DNA-binding superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03