SimpleSearch - Line and FST details


Line specific information

 
Line ID 764A03
Vector Used pGABI1
Line Availability only available from NASC (N473251)
Segregation Analysis 50:50:38
Confirmed for Hit At1g69870
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g69870

 
Sequence (A. th genome BLAST matches underlined)
>17-K023908-022-764-A03-8409
TTTACATTGAATATATCACGGTACACACATGAAGTGATTGATAAATGTAGAGAGTGGGCA
CCACATACAGACACTTTCTCTTTGTTAGAAGCTTTTTTGGGTGTAGTGAATTATTTGTGG
AAGTGTGTATATATAAGGGAGTGAGTAGATAATATATGGTGGGTGTGGGTAAATTTGAAT
GACGTTCGCCACTAGTAGCCTCCACGTGAGAAGTTTGAAGAGGAAAATTAAAAGAAAACT
ATTTTAGTGCTATGTTTTTTTTGTTTTTCTTACACCGTATGGGATCCTCCCTATAGTGAG
ATTTTATTTTTAGGCTTCGCGTATGGGATCCTCCCTATAGTGAG
GenBank Accession CU589937 [GenBank]
Graphic View Graphic view of gene At1g69870
Predicted Position of Insertion Chr1:26316111 - go to primer design
BLAST e Value 4e-126
Hit Clone Code (BAC ID) T17F3
Hit Gene Code At1g69870 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation nitrate transporter 1.7
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX896980 [GenBank]


Last Updated on 07.07.2016 14:03