SimpleSearch - Line and FST details


Line specific information

 
Line ID 764D11
Vector Used pGABI1
Line Availability only available from NASC (N473295)
Segregation Analysis 60:59:43
Confirmed for Hit At1g35520
Parent of DUPLO pair none
Parent of pair(s) 11114, 89229, 89232, 89242, 89243, 89244, 89245, 89247, 89248, 89249, 89250, 89251, 89253, 89254, 89256, 89259, 89264, 89265

Gene hit At1g35520

 
Sequence (A. th genome BLAST matches underlined)
>84-K023870-022-764-D11-8409
AAGAAACATTATAATTGGAATATATTTATGCCTAAATTCCTTTTCATCTACTGTTACCTT
CCTTCAGATAAATCCTCAACCCTCAATCGAATTGTAAATCTTGAACCCACATTGAACTGA
TTGTACCGAGCCTCCAAAAATTTGTCCTAACCGACAATAAATTGACCTGACCTGATACTT
ATAAAAACACAAAATATAAACCTATATGTTGAAGGAACTAATCCATTGATAAATCAATAT
AATCTAAAATGTGAGTTCAAATGGTTCTTTGAATTACCTTGGCTTGTAAACCACAATGAA
CATACATTGGTTATCAAAAGCATGCTTTGCCGAAGCAATTAACCCATGTCTCATACAATC
TATTGATACTATTGATGAAGGTATATTCCCTTGTTGATGTCTTGCTCGACTGATACCAAC
TCGTAACTCTCCAGACTCTCCCCTAAAACTACAAGTAAATAGTTTAAAGTCCAAAACTCC
AGACCCCAAAAATATATAAC
GenBank Accession BX897093 [GenBank]
Graphic View Graphic view of gene At1g35520
Predicted Position of Insertion Chr1:13084103 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F15O4
Hit Gene Code At1g35520 [TAIR] [MIPS] [SIGnAL]
Gene Annotation auxin response factor 15
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX897094 [GenBank]


Last Updated on 14.10.2014 10:23