SimpleSearch - Line and FST details


Line specific information

 
Line ID 765B02
Vector Used pAC161
Line Availability only available from NASC (N473358)
Segregation Analysis 50:49:45
Confirmed for Hit At1g77640
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g77640

 
Sequence (A. th genome BLAST matches underlined)
>10-K023592-022-765-B02-8409
CATGGGGAAACGAGAACTCAAGATCCAAGTTACTTACTTCCTCATCATCACTCTCTCATT
CTTCATCTTCTTCTTCTTCTTCGACGTCGGCACTACGTCATCAATCTTGTAAGAACAAGA
TAAAGAAGTATAAAGGTGTGAGGATGCGAAGTTGGGGATCATGGGTTACTGAAATTAGGG
CACCAAATCAAAAGACAAGAATCTGGTTAGGTTCTTACTCCACCGCAGAAACAGCTGCTA
TGGGATCCTCCCTATAGTGAGTCGTATTACTCACGGGGTCAGCCCGAAATGGAATCTCAG
TGGGTAAGTCTCTCTTTGGAGAAAAAGGAAATAAAGGACACTGGAGCGCAAATACTAATA
ACAGCTCATGAAATACAAATATGATAAAAAGACTCAAAAAATACAACTAGAATAAATAAT
ACGCCCTCTTCAGCCATAAAAT
GenBank Accession BX897239 [GenBank]
Graphic View Graphic view of gene At1g77640
Predicted Position of Insertion Chr1:29178723 - go to primer design
BLAST e Value 2e-81
Hit Clone Code (BAC ID) T5M16
Hit Gene Code At1g77640 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Integrase-type DNA-binding superfamily protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX897238 [GenBank]


Last Updated on 31.08.2016 09:40