SimpleSearch - Line and FST details


Line specific information

 
Line ID 768A06
Vector Used pAC161
Line Availability only available from NASC (N473638)
Segregation Analysis 50:44:43
Confirmed for Hit At4g34650
Parent of DUPLO pair none
Parent of pair(s) 9566

Gene hit At4g34650

 
Sequence (A. th genome BLAST matches underlined)
>41-K023590-022-768-A06-8409
GCAATAAGCCATTTACATTGAATATTTCCCGGACATGAAGACATTGATCCATTGCTGATC
CATGATTTTTCTTGCATGCTACAAACAAAGGTATGTATACGTTACTACATTTCCTGTGTA
TAGTGTTGGTAACTATGGGATCCTCCCCATATTGAGACATATTACCCACACAATTACGAC
GAGTTTTAACCCCACCCATACGCTCACCATCAGGAAACGCATGTACATTGTTCCTTGATA
ACGCAGGTGTTCCTGTCGCCACGATCTACTCCAACTAAACAGAACATGTCACATCCACAT
AAACATTTCTCTGGTTGATATCTCACGCAGAGTAA
GenBank Accession BX897428 [GenBank]
Graphic View Graphic view of gene At4g34650
Predicted Position of Insertion Chr4:16544326 - go to primer design
BLAST e Value 3e-34
Hit Clone Code (BAC ID) T4L20
Hit Gene Code At4g34650 [TAIR] [MIPS] [SIGnAL]
Gene Annotation squalene synthase 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23