SimpleSearch - Line and FST details


Line specific information

 
Line ID 768C01
Vector Used pAC161
Line Availability only available from NASC (N473657)
Segregation Analysis 50:42:26
Confirmed for Hit At1g07725
Parent of DUPLO pair none
Parent of pair(s) 91829, 91835, 91838

Gene hit At1g07725

 
Sequence (A. th genome BLAST matches underlined)
>03-K023594-022-768-C01-8409
AGATCCAGCGTCCATAGCGAGAAAACTAATGCCCGGGCTATACGGGATTTCTATAAGAAA
CACCCGAGTCGGGTCATGCAATATTGTCAGATTTACCCCTGAAGATCTAAATAATTACAT
AACCGACCTATATGTTGGTTTAGGAAGATCCGTGCCCGTATCCAAAACTAAGAAGTATAT
GGTTAGCCCAAGCCATACGACGGATTTGAAGTAATAGCTCCATGTAAAAAGCCCTCATAC
GTGTAACTCTGTGAAATCAACGAATCATAGGCCGGTCCTATGGGATCCTCCCTATAGTGA
GACNTATTACTC
GenBank Accession BX897448 [GenBank]
Graphic View Graphic view of gene At1g07725
Predicted Position of Insertion Chr1:2395453 - go to primer design
BLAST e Value 3e-139
Hit Clone Code (BAC ID) F24B9
Hit Gene Code At1g07725 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation exocyst subunit exo70 family protein H6
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40