SimpleSearch - Line and FST details


Line specific information

 
Line ID 769H12
Vector Used pAC161
Line Availability only available from NASC (N473824)
Segregation Analysis 50:50:34
Confirmed for Hit At5g35770
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g35770

 
Sequence (A. th genome BLAST matches underlined)
>96-K024647-022-769-H12-8409
ATCCGGAATGAGCCTTTACAATTGAATATATCCTGAAAAAGAATTAAAGCCATTCAATTG
AATATATCCTGAAGCCATTGGTAATATCATATTCACTTAATTATGATCTAAAGAGTAAGA
ATTCGTTATACCAAAAAGAATTAGAACGGCAGAATCAAATCTAAGCTTAGAAACAACTAA
AGTACAAGACACTTGAAACAAGCAGTACATTTGACTATGGGATCCTCCCTATAGTGAGAC
TAAGGAATCGGGGGAATCGGGGGATTTGGGGAGACGTTGGGCATCGAACCCCCCGGTGGG
AGCGGGCCAAAAGGGAGACTAAGGGAAAG
GenBank Accession BX946723 [GenBank]
Graphic View Graphic view of gene At5g35770
Predicted Position of Insertion Chr5:13940159 - go to primer design
BLAST e Value 1e-64
Hit Clone Code (BAC ID) MXH1
Hit Gene Code At5g35770 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Transducin/WD40 repeat-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX946722 [GenBank]


Last Updated on 07.07.2016 14:03