SimpleSearch - Line and FST details


Line specific information

 
Line ID 777F01
Vector Used pAC161
Line Availability only available from NASC (N474557)
Segregation Analysis 50:46:41
Confirmed for Hit At5g17030
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g17030

 
Sequence (A. th genome BLAST matches underlined)
>06-K024865-022-777-F01-8409
ACATTCGTCCAACAATCCTCCAAAATTCTCAAAGGAGCTTCCTTTGGTAGAGACAGCTTC
TTGTGCTATGGGATCCTCCCTATAGTGAGACTTAGTACTCATGAGTTTAGTATGTAATGT
TAGTAAATTGAGCTGTGTTTTCTTATTCGTAACCTAGATTGGATGGATTGTTTCTAGGCT
CAGTGTGACGATAAAGCCACACTCCATGATCCTCGCCGTTATGCTTACTGAGCAGTCGGA
TGTACTGAATTTCGTAGTGGCACATGAAATATTGGCGATTCTTGCTATTGTGCATTTGGC
GTATTAAAATGTTGTATATCACGACTCTGAAATAGGTATTTATAATGGTACGACTGTTTA
CTTGACAAAAGGGAGAGATAGTGTTGTTAAAGGGAGAGATATAAAAGAAAGAATAGATTA
TTAAGATT
GenBank Accession BX947151 [GenBank]
Graphic View Graphic view of gene At5g17030
Predicted Position of Insertion Chr5:5603210 - go to primer design
BLAST e Value 8e-29
Hit Clone Code (BAC ID) F2K13
Hit Gene Code At5g17030 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation UDP-glucosyl transferase 78D3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX947151 [GenBank]


Last Updated on 31.08.2016 09:40