SimpleSearch - Line and FST details


Line specific information

 
Line ID 778C04
Vector Used pAC161
Line Availability only available from NASC (N474620)
Segregation Analysis 50:49:36
Parent of DUPLO pair none
Parent of pair(s) 3594

Gene hit At3g29035

 
Sequence (A. th genome BLAST matches underlined)
>27-K024661-022-778-C04-8409
TCGTGGAATTCACAACATTCTTCAGATACTGAAGATGTTGCTTGACAATGAAGAAACCCA
ATTTAAGAAGAATCTTCACAATTCAGGTTCATCAGAGAGTGAACTAACAGCGAGTTCTTG
GCAAGGTCACAATTCTTATGGTTCCACTGGTCCAGTGAATCTTGATTGCGTTTGGAAATT
CTGAATTTGGAAAATCGAAAATTTGGATGTTAACTATGGGATCCTCCCTATAGTGAGTCG
TATTACTCACGGGTTTATACAAAATTGGTAAC
GenBank Accession BX947218 [GenBank]
Graphic View Graphic view of gene At3g29035
Predicted Position of Insertion Chr3:11034840 - go to primer design
BLAST e Value 1e-104
Hit Clone Code (BAC ID) MRI12
Hit Gene Code At3g29035 [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAC domain containing protein 3
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 14.10.2014 10:23