SimpleSearch - Line and FST details


Line specific information

 
Line ID 782H09
Vector Used pAC161
Line Availability available as T3 set from NASC (N475069)
Segregation Analysis 50:50:49
Confirmed for Hit At5g39660
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g39660

 
Sequence (A. th genome BLAST matches underlined) 
>72-K024663-022-782-H09-8409
GCATAACTTTATCAATAAAACTAAGATTTGACCAATCTAACATAAACCCATCAATCATTT
CCATTTAACAAATCAAAATCAATTCACAAGTTCCAAAAAAAACTAACCTTTTTATCAGTC
TCGCTCTCTCCTCCACCATCACCAACATCATCACCTTCTTCTCGTCCTAAACCGGAATCA
CCCATCTCTTCATCATCATCATCGCCGGTACACGAATCTGATAACCGAACAGGAATCTGA
GTTTCGGTTAAAAATCCGGTATAGCTATGGGATCCTCCCTATAGGGA
GenBank Accession BX947668 [GenBank]
Graphic View Graphic view of gene At5g39660
Predicted Position of Insertion Chr5:15879287 - go to primer design
BLAST e Value 2e-134
Hit Clone Code (BAC ID) MIJ24
Hit Gene Code At5g39660 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cycling DOF factor 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37