SimpleSearch - Line and FST details


Line specific information

 
Line ID 783H06
Vector Used pAC161
Line Availability only available from NASC (N475162)
Segregation Analysis 50:39:34
Confirmed for Hit At5g04940
Parent of DUPLO pair none
Parent of pair(s) 7903

Gene hit At1g76810

 
Sequence (A. th genome BLAST matches underlined)
>48-K025723-022-783-H06-8409
GAAGCCATTTACAATGTGAATATATCCTGGAGCGAGGGACACTACAATCTGATCGACGGA
TATGGGATCGTCCCTATACCGAGACCCTTCTTAGAGGCATCTTTTGCTCGGTTAGCACGT
TTTGTCCGTGTAGCTTCTTCCACTTCAGGTGTAGCTTTTACGGCAGCTATTACCTGGTTT
GCACTGTATGGCATCCTCCCTATAATGAGGTTGCGAGAGAAGCAGTCGATCCGTGAGATC
AGCCGACGCACCGGGCAGGCGCGCAACACGATCGCAAAGTATTTGAACGCAGGTATGGGA
TCCTCCCTATAGTGAG
GenBank Accession FR815802 [GenBank]
Graphic View Graphic view of gene At1g76810
Predicted Position of Insertion Chr1:28834116 - go to primer design
BLAST e Value 2e-38
Hit Clone Code (BAC ID) F28O16
Hit Gene Code At1g76810 [TAIR] [MIPS] [SIGnAL]
Gene Annotation eukaryotic translation initiation factor 2 (eIF-2) family protein
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At5g04940

 
Sequence (A. th genome BLAST matches underlined)
>48-K025708-022-783-H06-8409
CCCTTCTTAGAGGCCTCTTTTGCTCGGGCATCACCTTTTGTCCGCGTACCATCTTCCACT
TCTCGTGTCACCTTTTCCTATTGCCTTTCACTGTATCGCCCGCATGAGACCCTCTCTCTA
AAGTGGTATTCTCAGGCCGAGAAATGGGACGCTTTTTAGGGATCCTTCTTTTCACAGTTG
ACCCCTCAAGTTCCGCGTTGCCATTAGACACATCAGGAGATCTAAATGACCTTAAAGGAG
TAACCAACGAAGGCTCAGATGCATGCTGAGGAGGCTGCTGCTGATATACCGGTGGTGGAT
TCTGAGGCTGCTGATGTTGCTACGTAAACTGACCTGGGGGGGGAAGAAAATTGATCAAAT
TACACTACCCAGCATACCGCCACTTACAATTAAAC
GenBank Accession CR398648 [GenBank]
Graphic View Graphic view of gene At5g04940
Predicted Position of Insertion Chr5:1456030 - go to primer design
BLAST e Value 8e-106
Hit Clone Code (BAC ID) MUG13
Hit Gene Code At5g04940 [TAIR] [MIPS] [SIGnAL]
Gene Annotation SU(VAR)3-9 homolog 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23