SimpleSearch - Line and FST details


Line specific information

 
Line ID 784C05
Vector Used pAC161
Line Availability only available from NASC (N475197)
Segregation Analysis 50:48:46
Confirmed for Hit At1g75850
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g27650

 
Sequence (A. th genome BLAST matches underlined)
>35-K024928-022-784-C05-8409
GNAGCCATTTACAATTGAATATATCCTGGAAGTCCTAAAGTCTGTTGGAGTAGGGAATAC
CGACCGTTCTCATAGATCCTTTTAGGAGATAATGGCACCTCAGAAATAGTTGATCCGAAA
GCCCCTGACAAAGCATTGACATAACGATGGCATCCTCCCTATAGCGAGACTTATGACGCG
CTTTGACCCGAATTATTGCCACAACTGAGCCATGACACAGAAACTCGTTAGTATTCCCAA
GCATTGAAGAACAATAGACAACTTCGAATTAAACTATGGGATCCTCCCTATAGTGAGTCT
GATTACTCATGGGTC
GenBank Accession BX947707 [GenBank]
Graphic View Graphic view of gene At1g27650
Predicted Position of Insertion Chr1:9616564 - go to primer design
BLAST e Value 4e-43
Hit Clone Code (BAC ID) T17H3
Hit Gene Code At1g27650 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation U2 snRNP auxiliary factor small subunit
Insertion Classification TS2TE (3')
Confirmation Status unknown

Gene hit At1g75850

 
Sequence (A. th genome BLAST matches underlined)
>35-K024868-022-784-C05-8409
CTGGACGCCCATTGATGTTTTGGAAGCAGGTATCAGAACACTTCGAATTTGACGGTGTAG
AAAAAAATGTGAGCAGTGAATCATTTAGTAAGAACTTGTTCGACTGAGGTTTGACACTGC
GATGTGCTCGCTACCGAGTTATATTGATGTTTTTCGTTCCTCTCTGACCTTAATAAATAA
TTTGACAACCGACTGTTGACACGAATAGTAGTGTTAACCCATCTAGTGGACCGGTTATCA
TACTATGCTGCCTCGAGTCCAGATGTAAGTTCCCATTGAGCTATCATCGTTCCTTTTTAT
TTTTGTTTGTTAGCTATGGGATCCTCCCTATAGTGAGACNNATTANTC
GenBank Accession BX947706 [GenBank]
Graphic View Graphic view of gene At1g75850
Predicted Position of Insertion Chr1:28482038 - go to primer design
BLAST e Value 1e-58
Hit Clone Code (BAC ID) T4O12
Hit Gene Code At1g75850 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation VPS35 homolog B
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40