SimpleSearch - Line and FST details


Line specific information

 
Line ID 784D04
Vector Used pAC161
Line Availability only available from NASC (N475208)
Segregation Analysis 50:47:29
Confirmed for Hit At2g20960
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g20960

 
Sequence (A. th genome BLAST matches underlined)
>28-K024928-022-784-D04-8409
GAAGCCATTTACATTGAATATATCCATGTAGATTTCCCGCACACCGCAACACCGGCTCTG
CACACCAAGAGGACGCCTTTTTCACTATGGGATCCTCCCTATAGTGAGTCGTATTACTCA
CGGGGCTAGACGGAATTGGTAACTCAATGGGTTATGGGGTATTGGGAGTTGGGGGGATTG
TGGGCTTTTGGGGATTTGGGGTTATGGGGGGGGGGGGGGTTTGTGAGGTATAAGGTATAG
GGATAATTGGGGAATGTAGTGTTTTTGGTTTTATGGGAAATGGTATATAAAAAGGAATTG
GGGAGGTGGGGTATGGAGGGTTTTGAGGGGGAGGAGGGGTAATGATTTGTTAGGAAAAAT
AGAGATGGACTGAGATAGGAACAGAAATTATCGGAGGTGAAAGGTTAAGAATAGTAAATG
ATTTAGATGTGGGGGGTGGGAAAGCGATATCGGATATATGAGAGAGAGATTTTGATCTAA
AAAGGATAGA
GenBank Accession BX947721 [GenBank]
Graphic View Graphic view of gene At2g20960
Predicted Position of Insertion Chr2:9007770 - go to primer design
BLAST e Value 2e-10
Hit Clone Code (BAC ID) F5H14
Hit Gene Code At2g20960 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation phospholipase-like protein (PEARLI 4) family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX947721 [GenBank]


Last Updated on 31.08.2016 09:40