SimpleSearch - Line and FST details


Line specific information

 
Line ID 784G09
Vector Used pAC161
Line Availability only available from NASC (N475249)
Segregation Analysis 50:50:41
Confirmed for Hit At2g30590
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g30590

 
Sequence (A. th genome BLAST matches underlined)
>71-K024928-022-784-G09-8409
AGCCATTTACAATTGCTGACCCTCTTTTTAGCTCTACAAGCATACCAGGAACCCCTCTTA
CTTTTCCCTCTTCTTCATTCCCTCTCTCTCTATATCTCCCAATTCCTTCTCTTTTTTTAA
CCTTGATCTTCTTCTTATAAGAGACTCAGAGCTGTTCTTCAAGATGGGATTGTGTAAGCT
TGAAACTTGACTATCTGGGTCTCTCCCATTTTCTGTTCTCTTTTGTATTCTGAGTGAAAG
TTTTGTTTTCTGGGGGAAAAAATTAGGGTTCTTAGATGGAGGAGATAGAAGGAACAAACA
GAGCAGCTGTTGAGAGTTGTCATATAGTTCTTAATCTTTTACATAGATCACAGCAACAAG
ATCATGATGGTTTTGAACAGAATTTAGCATCTGAAAC
GenBank Accession BX947772 [GenBank]
Graphic View Graphic view of gene At2g30590
Predicted Position of Insertion Chr2:13033649 - go to primer design
BLAST e Value 5e-147
Hit Clone Code (BAC ID) T6B20
Hit Gene Code At2g30590 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation WRKY DNA-binding protein 21
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX947771 [GenBank]


Last Updated on 07.07.2016 14:03