SimpleSearch - Line and FST details


Line specific information

 
Line ID 784H03
Vector Used pAC161
Line Availability only available from NASC (N475255)
Segregation Analysis 50:50:44
Confirmed for Hit At1g01420
Parent of DUPLO pair none
Parent of pair(s) 97380, 97381

Gene hit At1g01420

 
Sequence (A. th genome BLAST matches underlined)
>24-K024868-022-784-H03-8409
ATGAAGCCATTTACAATTGAATATACATGTAGACGAAACGGTGTCGTGTGAGTTTAGGGA
ATTAACCGAACCGGTTATTATTCCCGGTTGTGTCCCCATAACCGGTAAGGATTTCGTCGA
TCCGTGTCAAGACCGAAAAGATGAATCATACAAATGGCTTCTACACAACGTCAAGAGATT
CAAAGAAGCTGAAGGGATTCTATGGAATCCCCTCTACAATGAGAAGCCAAACACTATAAA
GATTGTACAAGAACCGGCTCCTGATAAACCACCGGTTTACCTGATTGGGCCGTTGGTTAA
CTCGGGTTCACACGATGCTGACGTGAACGATGAGTACAAATGTTTAAATTGGCTATGGAA
TCCTCCCTA
GenBank Accession BX947778 [GenBank]
Graphic View Graphic view of gene At1g01420
Predicted Position of Insertion Chr1:155551 - go to primer design
BLAST e Value 2e-158
Hit Clone Code (BAC ID) F6F3
Hit Gene Code At1g01420 [TAIR] [MIPS] [SIGnAL]
Gene Annotation UDP-glucosyl transferase 72B3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23