SimpleSearch - Line and FST details


Line specific information

 
Line ID 787D12
Vector Used pAC161
Line Availability only available from NASC (N475504)
Segregation Analysis 50:49:37
Confirmed for Hit At3g52760
Parent of DUPLO pair 1348
Parent of pair(s) none

Gene hit At3g52760

 
Sequence (A. th genome BLAST matches underlined)
>20-K105032-0022-787-D12C-35St
ATTTATCACAAATGGGACCCGCCGCCGACAGAGGTGTGATGTTAGGCCAGGACTTTGAAA
ATTTGCGCAACTATCGTATAGTGGCCGACAAATTGACGCCGAGTTGACAGACTGCCTAGC
ATTTGAGTGAATTATGTAAGGTAATGGGCTACACTGAATTGGTAGCTCAAACTGTCAGTA
TTTATGTATATGAGTGTATATTTTCGCATAATCTCAGACCAATCTGAAGATGAAATGGGT
ATCTGGGAATGGCGAAATCAAGGCATCGATCGTGAAGTTTCTCATCTAAGCCCCCATTTG
GACGTGAATGTAGACACGTCGAAATAAAGATTTCCGAATTAGAATAATTTGTTTATTGCT
TTCGCCTATAAATACGACGGATCGTAATTTGTCGTTTTATCAAAATGTACTTTCATTTTA
TAATAACGCTGCGGACATCTACATTTTTGAATTGAAAAAAAATTGGTAATTACTCTTTCT
TTTTCTCCATATTGACCATCATACTCATTGCTGATCCATGTAGATTTCCCGGACATGAAG
CCATTTACAATTGAATATATCCTGTAACAGAAATTGAAAATAATTCCAGTAACAGGCGAC
TACTACGCATTCTTCGTGTTCGTATCTTCGTGATATGTGATAAGGGCATTTTCGGTAAGT
GAATTAATAATGTTTTGGGCCGTATAAGGCTTTATCAGCCCATTAGTTTGTAGTTTTGAA
CAGCCTTTGCTACACAAACAAGTCAATAGCCCCACTTGTGAGTTGTGAATAGTTTTCACT
ACTGACTAATTATCGTAATTTTATAAGTTATTAGGCTCACTGAACAACAAAGTCGTTGTA
GTATAGTGGTAAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACG
GCGATTTTTTATTTTTTAAACCTATAGTAGTGTCCTTACCATTTTTTGAAAGTCATTTAG
AATTTGTATAAATTGTAAGAGCAATGATCAATACGTAAGTCATTTAGAATTGTTAAA
GenBank Accession HG969124 [GenBank]
Graphic View Graphic view of gene At3g52760
Predicted Position of Insertion Chr3:19554772 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F3C22
Hit Gene Code At3g52760 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Integral membrane Yip1 family protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX948117 [GenBank] BX948117 [GenBank]


Last Updated on 31.08.2016 09:40