SimpleSearch - Line and FST details


Line specific information

 
Line ID 787G04
Vector Used pAC161
Line Availability only available from NASC (N475532)
Segregation Analysis 50:50:46
Confirmed for Hit At4g32950
Parent of DUPLO pair 2685
Parent of pair(s) none

Gene hit At4g32950

 
Sequence (A. th genome BLAST matches underlined)
>31-K024947-022-787-G04-8409
GAAGCCATGTACAATTGAATATATCCTGCCCCTAGACTGAAGAACACAAAGACCCCAAGT
TTTGAGGAGATCCATGGTGATCATATTATACAACTGCGTTTTCTTGTCCATAATCAATAA
TCTCATAAATCTGACTTTTATCTGTTGATCCTCCTGAGGATAAACAAAAACAAAATCCCA
TAATTTTCTTTTCTTCTTTTGTGTTTTGCCTTTTTTTTTTTTTTTTT
GenBank Accession BX948152 [GenBank]
Graphic View Graphic view of gene At4g32950
Predicted Position of Insertion Chr4:15905862 - go to primer design
BLAST e Value 2e-41
Hit Clone Code (BAC ID) F26P21
Hit Gene Code At4g32950 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein phosphatase 2C family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX948152 [GenBank]


Last Updated on 31.08.2016 09:40