SimpleSearch - Line and FST details


Line specific information

 
Line ID 787G12
Vector Used pAC161
Line Availability available as T3 set from NASC (N475540)
Segregation Analysis 50:50:39
Confirmed for Hit At5g46370
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g46370

 
Sequence (A. th genome BLAST matches underlined)
>95-K024947-022-787-G12-8409
AAAAAGCTGCTTCCTTTATCTCCACCATTATCGGAAAACGACCCTATGGGATCCTCCCTA
TAGTGAGTCNNATGNTTCATTGNTNTCCCNNTANNTTGTNNCCTNNTCTGCTTTTNTNCC
CNCNTNNNNCNNGTCNNTTTCTTCCTNCNTTTCCCCCTTCTCCCTTCTTCTTTTTTCCTG
T
GenBank Accession BX948161 [GenBank]
Graphic View Graphic view of gene At5g46370
Predicted Position of Insertion Chr5:18811816 - go to primer design
BLAST e Value 4e-15
Hit Clone Code (BAC ID) MPL12
Hit Gene Code At5g46370 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ca2 activated outward rectifying K channel 2
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX948161 [GenBank]


Last Updated on 10.06.2021 13:37