SimpleSearch - Line and FST details


Line specific information

 
Line ID 788F09
Vector Used pAC161
Line Availability only available from NASC (N475621)
Segregation Analysis 50:47:38
Confirmed for Hit At2g25900
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g25900

 
Sequence (A. th genome BLAST matches underlined)
>70-K024821-022-788-F09-8409
ATTGAATAACTCGTTTGACGGGAGGTAACGGAAGAGAGAAGCGAAGGAGTCGAGATACGG
TGACGGAGAGTGTGGGTAGTCGTTAACGCTGTTAAGGTTGACGGAAGAGAATGGTGAAGA
GATTGTGGCCGTTGGATCGTTGATTTGATCCCATTGAGGGATATGGATCGTTGGATGTGG
CCGGTTTTTATTTTCGCCGATCATCATTTTTGTTTAGGGAGTCTATGGGATCCTCCCTAT
AGTGAGACGAATAACTCTCCGAATTACCCTTTTTTTT
GenBank Accession BX948289 [GenBank]
Graphic View Graphic view of gene At2g25900
Predicted Position of Insertion Chr2:11042017 - go to primer design
BLAST e Value 2e-118
Hit Clone Code (BAC ID) F17H15
Hit Gene Code At2g25900 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Zinc finger C-x8-C-x5-C-x3-H type family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23