SimpleSearch - Line and FST details


Line specific information

 
Line ID 793F10
Vector Used pAC161
Line Availability only available from NASC (N476102)
Segregation Analysis 50:50:44
Confirmed for Hit At1g78880
Parent of DUPLO pair none
Parent of pair(s) 69590, 97608

Gene hit At1g78880

 
Sequence (A. th genome BLAST matches underlined)
>78-K024938-022-793-F10-8409
TGGGATCCTCCCTATAGTGAGTCGTATTAGTCCCCCGCATTGTACTGAATTGAGTAACGC
TTTAGGCTTTTAGAGACTTTCCACACTGAAAGAGACCATTTTTCTGTGAAATGAAATATC
ATCATGCCACTACTAACCTCTGCTGATCTCAGTCCCCATGTAAAGCGACGATGTGAAGCA
TTGGCTGGCTTTGAACCCCATCCACGGTACTCATATAGACAAGTAGACGTGTAAACACAC
CTATGAGATCCTCCCTATAGTGAGTCAAATTACTCCTTACAACAAAGGAATTTCTAAAAA
AAAAACAAACCACATAACGATTTATTATGAGACTCGCACCTATTCTCAAGTTAAAGATGG
CATGCAAATTCTACTACATCCTAAATACTTCTTACTAATAACACCAAATTTACATAGAAT
TTCAGAATTAACAATATATAAATCAACATCTCTCTCTAAACAAAGGAAACTTATTGACCC
CAACACAACATACCGAAAAACCGTACACC
GenBank Accession BX948851 [GenBank]
Graphic View Graphic view of gene At1g78880
Predicted Position of Insertion Chr1:29653546 - go to primer design
BLAST e Value 1e-92
Hit Clone Code (BAC ID) F9K20
Hit Gene Code At1g78880 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ubiquitin-specific protease family C19-related protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX948851 [GenBank]


Last Updated on 31.08.2016 09:40