SimpleSearch - Line and FST details


Line specific information

 
Line ID 797B09
Vector Used pAC161
Line Availability only available from NASC (N476437)
Segregation Analysis 50:43:39
Confirmed for Hit At4g20140
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g20140

 
Sequence (A. th genome BLAST matches underlined)
>66-K024971-022-797-B09-8409
CGTATGACCTTACATGAACGACATTTATCTTTAGGAAGTTATTTTCGTTACGACTATTAT
GGTTCTACCAGCCTTGAGTTCAAACATGCCTTTTTGAGTTTCTCCATTCGATATCACGTG
TACGACTCTGTCCAAATCACCTGATTTATCAGAAAATATCCAAATTTTGGATTCCAGAAA
GCCTAGAACCCACCAATTTGAGCTCGTGACCCACTACGGGATCCTCCCTAAACTGAGACA
AAATTGTTATTGAGATCGATGTGTGTCAGTTTCTTGCACAAGACGAGCTGTAGCGGAATG
GTTCCTGTGAGAGCGTTGCTTGACATATCTAACAAGGACAGCTCGCGGATTTTCCCCAAC
GTCCAAGGGATTTTTCCTGTCAATTGATTCTTGCCTAACCTGAGACGATCAAGATTTTGA
GAGTTTCCTATGGGACCCTCCCTAGAGCGAGCCCAA
GenBank Accession BX949232 [GenBank]
Graphic View Graphic view of gene At4g20140
Predicted Position of Insertion Chr4:10886431 - go to primer design
BLAST e Value 5e-104
Hit Clone Code (BAC ID) F1C12
Hit Gene Code At4g20140 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Leucine-rich repeat transmembrane protein kinase
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit MOB24

 
Sequence (A. th genome BLAST matches underlined)
>66-K024951-022-797-B09-8409
TTTACAATTGAAATTGGTAATTACTCTTTCTTTTTGATAACACAGAGATATGGAGTCTGT
CTATTTTTATCTATGACGTCTATCAGTTTAATATTCGATCCCGATTATCATAATTGCATT
GTTTTTTTTTTTCCCAACCAAAAAAAAACCCCAGGGTTTTGCTCTTTGCCAGCAACAAAT
TGATTTTAAAAAAAAGTAAAAATTTGAAACCGACCTACCAAAGGGGGAAAAAAACTTTCC
CAACGCCACTATTCTGATTCGGGAAAAAAAATACCACCTAGGGGACCCCCCCAAAAGGGG
GGCTTTGAGAACACCGACATACAGAATGTGTGATGAAGGAGAGTATAGGAGAACCGCGAG
GCTATACGGGAGAGGAATACGCACAGAGAAATACGAAAAAAGTTGTATAGAAAAAGAACG
AGGAAAAGTACGAAGAACCATAGGAAGCAATCAGAAAGATA
GenBank Accession BX949231 [GenBank]
Graphic View Graphic view of sequence BX949231 of line 797B09
Predicted Position of Insertion Chr3:8926610 - go to primer design
BLAST e Value 3e-40
Hit Clone Code (BAC ID) MOB24
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 31.08.2016 09:40