SimpleSearch - Line and FST details


Line specific information

 
Line ID 797F08
Vector Used pAC161
Line Availability only available from NASC (N476484)
Segregation Analysis 50:50:36
Confirmed for Hit At1g25440
Parent of DUPLO pair none
Parent of pair(s) 11983

Gene hit At1g25440

 
Sequence (A. th genome BLAST matches underlined)
>62-K024971-022-797-F08-8409
TTGTCTGATCTTACGACTGTCGATCTTGGGCTGATCGACCTCGTTCAAGAACTGCTCAGA
CACCAACGGATCTATGGGAGCCTCCCTATAGAGAGTCTGATCTTTCAGCTCATAGTTGTC
TGTCTGATCCTCAATACTAATATCAGGAACCAAGTCATGAAATATCGACGAATTGTTTTT
CTTACCAGAGCCACGTGGCGTTCGAGCTTTACGAGTAAACCCGTGATGCCACGTGGCGAC
CTCATGTGGAGGAGAAGCTGATGAGTGGTTGCTATGCTTTACGACCGCCGGACTAGGCGT
TTTTCAATAGAGTGTATACTGAGATTGAGAAACTAGGGTCTTGGTGATTGGACATACCAG
GCGGATGACTGCTCTTTACATCTCTAGAGGGGGGGGGGTTGATCCTGCGCAATTTCCCTT
GCTATATCGACTGCAGCTCTTTCCCGATCTTGAACGCGCATCATATTTGTCATTTGTTT
GenBank Accession BX949301 [GenBank]
Graphic View Graphic view of gene At1g25440
Predicted Position of Insertion Chr1:8934799 - go to primer design
BLAST e Value 8e-103
Hit Clone Code (BAC ID) F2J7
Hit Gene Code At1g25440 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation B-box type zinc finger protein with CCT domain-containing protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03