SimpleSearch - Line and FST details


Line specific information

 
Line ID 799C05
Vector Used pAC161
Line Availability only available from NASC (N476637)
Segregation Analysis 50:50:48
Confirmed for Hit At5g21030
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g21030

 
Sequence (A. th genome BLAST matches underlined)
>35-K024973-022-799-C05-8409
CGCGAAGAAGCCATTTACATTGAATATAACAAAAAAGGAAGTTCCTGTTCTCTATTGGCT
TTTCTTTGAAACTTGAAGAATTTGATATTTGATCGACCATGACAGAATATCATAGCCGCA
TGAGTCTTGGTTCTTTCCTTTGAATTCCCAGATCCATTCCTATGGGATCCTCCCTATAGT
GAGATTCAAAAATCAAACAGTCATAATTTCTTCCATTACAGCGTGCGCTTTTTGTTTCCC
TTCCTGTTCCTGTTTCCATGACTTGATTTGGAAAACATACTTTATAGTGTGCTTTGTCTC
TTTGGATACAGGTTACTATCACATATGAAGATGGTAGTCCACTTTTAGCCAAAGGTTTTG
GCAGAAAGATTCTTGAAAAAGTTCAACAGACTTGTCAAGCTGATTTGGGTTGCAAACATT
TTGCTTATGATGGCGACGAGAATCTTTATACTGTTGGTCCACTTCCTATGGAATCCTCCC
TATATTGAGAAATA
GenBank Accession BX949503 [GenBank]
Graphic View Graphic view of gene At5g21030
Predicted Position of Insertion Chr5:7144271 - go to primer design
BLAST e Value 6e-150
Hit Clone Code (BAC ID) F22D1
Hit Gene Code At5g21030 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation PAZ domain-containing protein / piwi domain-containing protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX949503 [GenBank]


Last Updated on 31.08.2016 09:40