SimpleSearch - Line and FST details


Line specific information

 
Line ID 799C05
Vector Used pAC161
Line Availability only available from NASC (N476637)
Segregation Analysis 50:50:48
Confirmed for Hit At5g21030
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g21030

 
Sequence (A. th genome BLAST matches underlined)
>32-K118607-0022-799-C05C-8409
ACAATTGAAAAATATTACTATGTTTGTTGTATTGTAAGATTTTGAAATTCAGTTAGAAGT
TAGTGAACCTTCGAGGAATCTCTTGCATTTTTTCATACTAAAAGCTTCCAAAATATATGA
ACTAAAAGCCAATTTTCTCATTTTCCACCAATCATAAAGACCCAACTCTGATAGCTTAAA
AGTTAAAGCCAACATGTGTCAAGGTTATAAAATTGCTTTACTAAATGTATTAAAGATAAA
TCCAATCTTATCGCTTAGGCCTTCGCCTTCCCGCTTGCTCTTCGTTTACTATGCCAGGCT
CGGTTCCTTTCTCCATTGATGGGGTTCTTATGAGCAGCAATGGAGCATTGGTCAGGCCTT
CCATTCTTTGCGTTCATCTCCATTTGCATTCTCCTTCGTCTCATCCTATTCTCAT
GenBank Accession HG969133 [GenBank]
Graphic View Graphic view of gene At5g21030
Predicted Position of Insertion Chr5:7144808 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F22D1
Hit Gene Code At5g21030 [TAIR] [MIPS] [SIGnAL]
Gene Annotation  
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23