SimpleSearch - Line and FST details


Line specific information

 
Line ID 800H03
Vector Used pAC161
Line Availability only available from NASC (N476791)
Segregation Analysis 50:49:38
Confirmed for Hit At1g51950
Parent of DUPLO pair none
Parent of pair(s) 7939

Gene hit At1g51950

Sequence (A. th genome BLAST matches underlined)
>24-K025366-022-800-H03-8409
TTTACATATGAACTATCATGCAATGTGACATACTCTCATTGTCTCCTTTGACCTTCCTTA
TTGTCTATTCTTTGACTACATTTCTCCATTCCCATCGACAAGACACAGCAGAGCTGTAAC
TACATTATGGTATGATCACTGCATTTAATAATAATTAATACGGTCCCAAATATTTGTTTG
TATAACATGATTATACTATGGGAACCCCCCAAAGGTGAGTCGGGACCTTGTTGACCAGGA
AAATGACCTCTGAAAAGCTTGTCCGCTGCCTCCGATACCTGCTCATAGATGTTATGAGAA
GCTCCCTGCATCTTTACAACCAATGGGATGACCATCCTTGTTGATCTTCACACACCTGCC
TCCTTGTCTCTTTGGTTCTGTTGTCATANCAACAGCATCACACTTTTGGTTCTTGAGGGT
AACACCATTGGAGGTGGTTGATCCATGG
GenBank Accession CR359967 [GenBank]
Graphic View Graphic view of gene At1g51950
Predicted Position of Insertion Chr1:19306719 - go to primer design
BLAST e Value 2e-44
Hit Clone Code (BAC ID) T14L22
Hit Gene Code At1g51950 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation indole-3-acetic acid inducible 18
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Uehara et al. 2008, iaa18-gk]
Other FSTs Supporting this Hit CR359967 [GenBank]

Gene hit T2K10

 
Sequence (A. th genome BLAST matches underlined)
>24-K025200-022-800-H03-8409
CCTTTACATATTAACTAATATAGAATGTGATATATAATCATTGTCTCCTTTGACATTCCA
TATTGTTTATTCATTGCCTCTTTTCTACATAAAAAGGGACAAGAAACAGCAGATCAATAA
GTACATTATGGTATGTTCAGTGCATTTAATAATAATTAAGAAGGTCCCAAATATTTGTTT
GTATAACATGATTAGACTATGGGAACCCCCCAAAGGTCTTTCGTGATCTTGTTGACGATG
AGAATGACCTCTAAAAAAGATGACCGGAGCCTCCAATACCCGCTCAGAGATGATATTAAC
GATCCCTGCATGTTAAGAACCAATGTGATGCCCATATTAGTTGATCTTCACACACCTGCC
TCCTTGGCTCTTTGGTTCAGATGGCGAAACAGCAGCATCACACTTTTGGTTCTTGAGGGT
GACACCATTGTAGGTG
GenBank Accession CR359966 [GenBank]
Graphic View Graphic view of sequence CR359966 of line 800H03
Predicted Position of Insertion Chr1:22132586 - go to primer design
BLAST e Value 3e-99
Hit Clone Code (BAC ID) T2K10
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 31.08.2016 09:40