SimpleSearch - Line and FST details
Line specific information
| Line ID | 804C12 |
| Vector Used | pAC106 |
| Line Availability | not available |
| Segregation Analysis | unknown |
| Parent of DUPLO pair | none |
| Parent of pair(s) | none |
Gene hit F14J22
| Sequence (A. th genome BLAST matches underlined) | >91-K023441-022-804-C12-8409 AATAGATTCCTTTGCTATATATTACTCATTAACCTATGGGACCCTCCCTATGGAGA |
| GenBank Accession | FR816037 [GenBank] |
| Graphic View | 
|
| Predicted Position of Insertion | Chr1:18388146 - go to primer design |
| BLAST e Value | 4e-09 |
| Hit Clone Code (BAC ID) | F14J22 |
| Insertion Classification | Genome Hit |
| Confirmation Status | unknown |
|
Last Updated on 10.06.2021 13:37 |
gabi-kat.de 
