SimpleSearch - Line and FST details


Line specific information

 
Line ID 804D10
Vector Used pAC106
Line Availability only available from NASC (N477134)
Segregation Analysis 50:39:29
Confirmed for Hit T20L15
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit T20L15

 
Sequence (A. th genome BLAST matches underlined)
>76-K023441-022-804-D10-8409
TTCGGACATGAGCCATTTACCTATCGATGATACAACTTTTTAATATCATCGTGGTGCACA
TTTTAAAAGGATTACAATGACCACGATTAAACTATGAAATACTACCTATACGAGCTATGA
TATCCTCCCTAAATTATGTCTTAGGAACCAACACTACTTGTGTATTACTATTACTAAAAC
ATATAATAAAAGTGTCAGTGTCAAATGTCAATGTAATTTAATTTAGGGGAAAATGACATG
GCCAACATAATCTACCCCAAAATCAATGACAATGGAGAGAGCATCTCACTCACCTTATAA
TAACCCCTATATTTTC
GenBank Accession BX949901 [GenBank]
Graphic View Graphic view of sequence BX949901 of line 804D10
Predicted Position of Insertion Chr5:324121 - go to primer design
BLAST e Value 1e-104
Hit Clone Code (BAC ID) T20L15
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX949902 [GenBank]


Last Updated on 31.08.2016 09:40