SimpleSearch - Line and FST details


Line specific information

 
Line ID 807G12
Vector Used pAC106
Line Availability only available from NASC (N477460)
Segregation Analysis 50:45:29
Confirmed for Hit At3g04710
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g04710

 
Sequence (A. th genome BLAST matches underlined)
>95-K025203-022-807-G12-8409
GNAGCCATTTACAATTGAATATATCCATATTGAGCATCAGATAAGGCATGCTCAGCTTGT
CCTATGGGATCCTCCCTATAGTGAGTCGTATTACTCACGGGGCTACCCGGAATTGGTAAC
TCAATGGGATACCCCCAATAGGGAACTCAATGTTTTACCGCCAAAAGTTAATAGGCGTGT
TCCCTTAGAATATGAAGAAAAGGGAGAGGGGGGGGGCCTTGAGAATCAATATATTTACCC
CAGAAGTCGGTCTCGGGAGAAAGGGGTTATTGTCCATATAGGAACCGCAGAACAAGACTG
GTCCTGTATTGGCCTCAGGGAACAAACACATAGGAGAAGGGTGATCGTAGATAAAAGGAG
GCGATAAAAAGTGAAGGAA
GenBank Accession CR360033 [GenBank]
Graphic View Graphic view of gene At3g04710
Predicted Position of Insertion Chr3:1280550 - go to primer design
BLAST e Value 4e-09
Hit Clone Code (BAC ID) F7O18
Hit Gene Code At3g04710 [TAIR] [MIPS] [SIGnAL]
Gene Annotation ankyrin repeat family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR398699 [GenBank]


Last Updated on 14.10.2014 10:23