SimpleSearch - Line and FST details


Line specific information

 
Line ID 811B09
Vector Used pAC106
Line Availability only available from NASC (N477781)
Segregation Analysis 50:4:4
Confirmed for Hit At5g04640
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g04640

 
Sequence (A. th genome BLAST matches underlined)
>66-K025224-022-811-B09-8409
TTCCGCGAAGNAGCCATTTACATTGAATATATCCTGAAGATGATCCCTCGACCTGATTTC
TCGTTAAACAAAGATTCTCCAACAACACGGTGCGCGTGACCTCATGAAAATCCCCGAACT
ACCCTCAGACTCTGTTTTTTTTTCCTTGATTAAAAAGGCTTCCTTCGAGTTTTTCTTGTT
ATCATTCCATCCGAATATCTATCGCTTTTGTTTCTTCATCTTGTTCTCGTCAGATTTTGC
AGTCATTATAGTGATACAAGGACATGGCGCAGATTCCGAAATAGCTATGGAATCCTCCCT
ATATGGAGACAAAATATGGATGAGGACAATATCCACGTGTCTGATATGGACGACAAGGAT
ACGATGCTAATGATTTCTGACAAGAACAATGTTTTACCTGAAAACTTGGATGAATTCGAT
CAAGAGCTATGGGATCCTCCCTATAGTGAGTATTGTGTTGAAGGGAATATTTGGAACAGA
ATTAGAAAAAAAAGGAGGGAGAGAGAAAGAAACGAGTAA
GenBank Accession CR360409 [GenBank]
Graphic View Graphic view of gene At5g04640
Predicted Position of Insertion Chr5:1333202 - go to primer design
BLAST e Value 4e-61
Hit Clone Code (BAC ID) T32M21
Hit Gene Code At5g04640 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation AGAMOUS-like 99
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40