SimpleSearch - Line and FST details


Line specific information

 
Line ID 814B04
Vector Used pAC106
Line Availability only available from NASC (N478064)
Segregation Analysis 50:40:4
Confirmed for Hit At3g07880
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g07880

 
Sequence (A. th genome BLAST matches underlined)
>26-K025642-022-814-B04-8409
AGCCATTTACATTGAATATATCCTGGCATCACGATGGTTGTATGGCTCCAACTGAGGACT
AAAGGTTCCAAGCATTTCCTTAGCTCTGTCCACTGTAGCCATTAAAGAAAGGAATTGGAT
CACATTGTCTCTCAACCATCGAGAGGACCAATTAATTAAAAACAAACTTGTGGTCTATTG
TTTTACCTTTGACACCGGTCTTCCAAACTGTATTGGCGTATGGGATCCTCCCTATAGTGA
G
GenBank Accession CR399008 [GenBank]
Graphic View Graphic view of gene At3g07880
Predicted Position of Insertion Chr3:2515316 - go to primer design
BLAST e Value 4e-101
Hit Clone Code (BAC ID) F17A17
Hit Gene Code At3g07880 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Immunoglobulin E-set superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR399007 [GenBank]


Last Updated on 14.10.2014 10:23