SimpleSearch - Line and FST details


Line specific information

 
Line ID 814G03
Vector Used pAC106
Line Availability only available from NASC (N397508)
Segregation Analysis 42:6:2
Confirmed for Hit At1g76550
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At2g28400 can not be ordered because the confirmation of this insertion failed.

Gene hit At1g76550

 
Sequence (A. th genome BLAST matches underlined)
>23-K025604-022-814-G03-8409
GAGTGAGATGTTACACCTAACAAATAAAAACATTGATTTAGAAAATTCTGGGATGAACTT
AAAAAATCATATTTACACAAGTTAAGAACAAAACATCTACTAAAACAGACACCCGAAAAA
GAGGAAAAGTAGGTATGGGATCCTCCCTATAGTGAG
GenBank Accession CR399066 [GenBank]
Graphic View Graphic view of gene At1g76550
Predicted Position of Insertion Chr1:28725425 - go to primer design
BLAST e Value 5e-67
Hit Clone Code (BAC ID) F14G6
Hit Gene Code At1g76550 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Phosphofructokinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At2g28400

 
Sequence (A. th genome BLAST matches underlined)
>23-K025642-022-814-G03-8409
GAGTTTGAGGAAATGCCCTTGGAAATTTCGTATAAGTTTGCGATTTTATCCAAACGAAAC
GATGACTGTCAAGGGCTCTACACGGCAACCGATTAAAAGGTTATTTTATTTTAACTTGTG
GTTTATTCAATTATTAACTACGCTGTGAATATTTGAATCATGTGTTAAAGAAGAGAACGC
AATTTATTATATTTCTTCGAAATTTCGTAGGAAGATGAATTGGAAAACAATAATAACTCT
TACATGGATGGAATTTATTAACAAACCAGATTTTTTTTTTCTCAAACACCGTTTTCCTCC
TTTGACAAGGGTATTAGTTATAAAGTATTAGTATAATCTAAGCAAGCATACCGGATCCGA
TTTCATAAAAAATAAATTTAGTATGGGATCCTCCCTATAGTGAG
GenBank Accession CR399067 [GenBank]
Graphic View Graphic view of gene At2g28400
Predicted Position of Insertion Chr2:12149128 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T1B3
Hit Gene Code At2g28400 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation senescence regulator (Protein of unknown function, DUF584)
Insertion Classification Promoter
Confirmation Status failed, line belongs to a contamination group, please check line 814G02


Last Updated on 31.08.2016 09:40