SimpleSearch - Line and FST details


Line specific information

 
Line ID 815G01
Vector Used pAC106
Line Availability only available from NASC (N478217)
Segregation Analysis 50:47:46
Confirmed for Hit At1g61970
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g61970

 
Sequence (A. th genome BLAST matches underlined)
>07-K025605-022-815-G01-8409
AATGTTTGTTACATAGAACTCTGCTTAATGATCACTTATGTATGGGATCCTCCCTATAGT
GATGATTTCCATTGAAAACTGATCCATGTGCACCTTCCCCCCTTTTTTTTCGAGCGACGG
GGCTTCGGACTGATCCACATGCCACTTTTAAACATCTTCCGTCGGATGGCGTTGCCAGAG
AATCAGTCGATCCGTGATATCGTCCTACCCGCCCGGCATGCGCTTCAACACTATCGCACA
ATATTTGAACGCATGTATGGGATCCTCCCTATAGTGAGTGTTATTTTCGGAATTTGTAGT
AATCCCATTGCCTGTTGTCATGTATGCTCTGATACTCCATGGAAAAAGGTTGGTATGGAA
TCCTCCCTATAGTGA
GenBank Accession CR399175 [GenBank]
Graphic View Graphic view of gene At1g61970
Predicted Position of Insertion Chr1:22904391 - go to primer design
BLAST e Value 7e-29
Hit Clone Code (BAC ID) F8K4
Hit Gene Code At1g61970 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Mitochondrial transcription termination factor family protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03