SimpleSearch - Line and FST details


Line specific information

 
Line ID 815G11
Vector Used pAC106
Line Availability only available from NASC (N478227)
Segregation Analysis 50:39:34
Confirmed for Hit At1g08060
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g31710

 
Sequence (A. th genome BLAST matches underlined)
>87-K025643-022-815-G11-8409
GCCATTTACAATTGGTATGTTCTGTCTTTAATGATTCGATATGTTTCTATAAGTAAACGT
GAAACGCACATGAAAGCAAAAAATTTCGTTTGTGATTATTTTTTCCGTTTCCACGTTATA
CTAACTATATATAGTATAGCTCAGGAAATGTGAATTGACCTTGTGGGTTCTGTTTTCTCG
TTCATGCAACCGCTAATATTGTTTTTTGGAACAACTGATCATATATGCGTATCATATGTG
GCCTTAATCTCACGAATTATGCGCATCATATATGCACACGTGTAACATGTTCCTGGCTGG
AAGGATGGATTTGAAAATATGAGATATAGGGTTGCTCGTTTTTAAATTCGATATGAATAA
ATACATATTTTAGAATGCTGATTTCTCTCCTGAAAACATGAGCCGTGGTTTTCATCAAGA
ACCACATCATCACATGTTTTCCCTTGACAACCTAGTAGGCATATTTGTGTTGCCAAAAAC
CGCAAAAGTATGGGATCCTCCC
GenBank Accession CR399188 [GenBank]
Graphic View Graphic view of gene At4g31710
Predicted Position of Insertion Chr4:15349450 - go to primer design
BLAST e Value 2e-177
Hit Clone Code (BAC ID) F28M20
Hit Gene Code At4g31710 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation glutamate receptor 2.4
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At1g08060

 
Sequence (A. th genome BLAST matches underlined)
>87-K025605-022-815-G11-8409
TTTACATTGAATATATCAAGCATACTTTCATCCCACTCAAATTTCAATACAAGACAGAAT
TCCATTGTCAAAAAGAAAATGCACATATATTGAGAATGCACAAAGTGACGTATTCATGAC
AAACATAGAGCTATTCACATTCGCAAGTAATAGAAAATGCACCTGGTAGAAGACAACTGC
TTTTAAACCATTCTTTTTTATATGAGTAAGCATTTTATCAAGGAGGTGAAGTTTCCCGCT
CGCTTTAATTTCTACATCCAGGATTTCATGCAACTCCAGATTCTTGGTGAGCAGTTGTTT
CAAAGATGCATCCATAACGTATGGATGGTCACAGGTCTGTCAACAAGTTGCAAACACATA
AAGAAGATTTTAATATATTCACACATTAACATGCAGAAAGAGGCCTTGAGAAAATGTGAT
GCTGACCGACAATAGTCGTATATCTAAGCAACCCCAAAACTGTCAAGTTTGCCAGGTTCT
ATGTGTTTCAAAAAAGCATAAAACAAATAGACCCAAAA
GenBank Accession CR399187 [GenBank]
Graphic View Graphic view of gene At1g08060
Predicted Position of Insertion Chr1:2507964 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T6D22
Hit Gene Code At1g08060 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ATP-dependent helicase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03