SimpleSearch - Line and FST details


Line specific information

 
Line ID 817A02
Vector Used pAC106
Line Availability only available from NASC (N478338)
Segregation Analysis 50:25:22
Confirmed for Hit At2g02450
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g02450

 
Sequence (A. th genome BLAST matches underlined)
>09-K025722-022-817-A02-8409
ATCTGAGGCTTGTAGACATATTATTTCCATGGAAACCTGACCCTTGTGCGCCTTCCCCCC
AACACGGTGAGCGACGGGGCAACGGAGTGATCCACATGGGACTTTTAAACATCATCCGTC
GGATGGCGTTGCGAGAGAAGCAGTCGATCCGTGAGATCAGCCGACGCACCGGGCAGGCGC
GCAACACGATCGCAAAGTATTTGAACGCAGGTATGGGATCCTCCCTATAGTGAGAATCCT
CCACAACAAGCATCATTCCCATGAGTAACCAAGTCAACAATAACGAACAAGGTATAGAAG
ACAATGATCATAGAGGCGGCCAAGAGAGTCATGTCCAAAATGAAGATGAAGCTGATGATC
ATGATCATGACATGGTCATGCCCGGATTTAAATTCCATCCTACCGAAGAAGAACTCCAAG
AGTTTTACCCTTCCCGAAAAGTTGAAGGCAACCGCTTTAATGTA
GenBank Accession CR399335 [GenBank]
Graphic View Graphic view of gene At2g02450
Predicted Position of Insertion Chr2:647768 - go to primer design
BLAST e Value 1e-107
Hit Clone Code (BAC ID) T16F16
Hit Gene Code At2g02450 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAC domain containing protein 35
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At1g30130

 
Sequence (A. th genome BLAST matches underlined)
>09-K025709-022-817-A02-8409
TTTTCTTGATTTATAACACTTTAAAACTGAAGCATTAGAGTCTATAATAACAATTGTAAA
TCTACTCCTTGTGTTAATACCCTACCGTTAAACGTGGCATTAAATCATAAATATACCACA
CCTCTGCATTTGAAGGGTCATCCATGTCAATCTCTGATTTTTGAAAAAGACCATATAGAG
ATACAGACACCGAGGTAGAGATATGGACTTGCTCTTTCTCCTCTGTTCAATCATCTACAC
TTCAATCACTTCCATCTTCTTCTCTCTTCTCCTCCCGTTTCGCTTCCTTCTCCACCGTCT
CCTTCCTTCACGCGCCGCCGTCGATCCTAATGTCTCTTTCTACGAAGGCACAGTCTGGCA
CGACCGTCTCCGTCCTGTCCGCCACTCTTTCCGTTATTCCGTTCGTTACGCACTCTTTGA
CCTCGACAAAGCTATTAACACACCGCCGGATCATTTCTCCGCCGACGAAGC
GenBank Accession CR399334 [GenBank]
Graphic View Graphic view of gene At1g30130
Predicted Position of Insertion Chr1:10587444 - go to primer design
BLAST e Value 1e-86
Hit Clone Code (BAC ID) T2H7
Hit Gene Code At1g30130 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation DUF1365 family protein
Insertion Classification Promoter
Confirmation Status unknown


Last Updated on 07.07.2016 14:03