SimpleSearch - Line and FST details


Line specific information

 
Line ID 817D04
Vector Used pAC106
Line Availability only available from NASC (N478376)
Segregation Analysis 50:43:33
Confirmed for Hit At4g40030
Parent of DUPLO pair none
Parent of pair(s) 6089, 6115, 6171, 6214, 7766, 8833, 10527, 81856, 81869, 81884, 81885

Gene hit At4g40030

 
Sequence (A. th genome BLAST matches underlined)
>28-K025709-022-817-D04-8409
AGCACATTTATAAATTGAAGTATATACCTAGGGCGGAGGCAGGCCCAATATGGCCCAAGA
GTTAGTGACCCCCCAGAGACCGAGGCGATATGCTTCTGCAACTTCCTGGAGAGCTAAGAC
AGCATGGCGTCTGGAAACGCAAATCAGTCTTGAAATCTTGAGCAATCTCACGGACTAGCC
TCTGAAATGGCAGTTTCCTGATAAGCAACTCAGTATGGGATCCTCCCTATAGTGAGATNN
TTTTATTTAAAATCCTAAAAGAGATCACATTGGTACAGACAAAAACAACAGAACAATAAT
AAAAATAATTAAAAAAATAAATAAAAAAACACAAAACAAAAAAATATCCAATCAAAAAAA
TACAAAATAAATAAAAACAGAGTGACTAAACTATACATAAATTAAATCTATAAATATAAA
CATTAAATAAGAGGAAAGAAAACATAAAAAAAATATCTACATATAACGTACTCCTAATAA
AACAATTTTTAACCACTAATAACACCACTTACATTAGATTAACAAACAACAAAATATAAT
AG
GenBank Accession CR399372 [GenBank]
Graphic View Graphic view of gene At4g40030
Predicted Position of Insertion Chr4:18555895 - go to primer design
BLAST e Value 7e-60
Hit Clone Code (BAC ID) T5J17
Hit Gene Code At4g40030 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Histone superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23