SimpleSearch - Line and FST details


Line specific information

 
Line ID 817G01
Vector Used pAC106
Line Availability only available from NASC (N478409)
Segregation Analysis 50:17:9
Confirmed for Hit At5g39410
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g39410

 
Sequence (A. th genome BLAST matches underlined)
>07-K025722-022-817-G01-8409
TTTACATTGAATATATCCTGTCACCGACAACCTCGACGTTACACGTCATTGTGAGTGAAA
TTGTAATTTAAGGAATAATAATCTGATTTGATTTTGATTGGTATATCAAATAGTAACACT
TGACTTCTCACACCATTTGTATGGGATCCTCCCTATAGTGAGACCTATGGAACCCCCCCA
ATAATGGCATCAATAATCCACTTCCTCATCTAACCCCCCATTTAAACTTCAATTTAAACC
CCCCTAATTAACTATTTCCTAATTACAATATTTTNTTTATTNCTTTCCCCTANAAATACN
ACNAATCCTATTTTCTCCTTTTATCA
GenBank Accession CR399402 [GenBank]
Graphic View Graphic view of gene At5g39410
Predicted Position of Insertion Chr5:15770380 - go to primer design
BLAST e Value 7e-57
Hit Clone Code (BAC ID) MUL8
Hit Gene Code At5g39410 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Saccharopine dehydrogenase
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR399401 [GenBank]


Last Updated on 07.07.2016 14:03