SimpleSearch - Line and FST details


Line specific information

 
Line ID 819B03
Vector Used pAC106
Line Availability only available from NASC (N478543)
Segregation Analysis 50:16:13
Confirmed for Hit At5g17420
Parent of DUPLO pair none
Parent of pair(s) 5444, 5458, 5539, 5541, 5562, 5596, 10385, 10394, 96721

Gene hit At5g17420

 
Sequence (A. th genome BLAST matches underlined)
>18-K025639-022-819-B03-8409
CCATTGCTGATCCACCCAACATTTGTTAAGGAACGTCGAGCCATGAAGGTCAGTGTATAT
CACCCTGATCTAGTTATACCACCACCCATCTTTTTCACTATAATCTAAACTTCATAAGTG
AAATTGACATATGACAGAGAGAATATGAGGAGTTCAAGGTCAGGATCAACGCTCAAGTGG
CGAAGGCCTCAAAGGTTCCTCTAGAAGGTTGGATCATGCAAGATGGAACACCGTGGCCAG
GGAACAACACCAAGGACCACCCCGGTATGATCCAAGTCTTCCTCGGCCACAGCGGAGGAT
TTGATGTCGAAGGGCATGAGCTTCCTCGGCTTGCGTATGGGATCCTCCCTATAGTGAGAG
ATAANTGGNAGCTTCGGCGCAAGTGAAATACCACTACTTTTAACGTTATTTTACTTACTC
CGTGAATCGGAGGCGGAGTATGGGATCCTCCCTATANTGAGNNNNNN
GenBank Accession CR399548 [GenBank]
Graphic View Graphic view of gene At5g17420
Predicted Position of Insertion Chr5:5739228 - go to primer design
BLAST e Value 3e-173
Hit Clone Code (BAC ID) T10B6
Hit Gene Code At5g17420 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Cellulose synthase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR399547 [GenBank]


Last Updated on 07.07.2016 14:03