SimpleSearch - Line and FST details


Line specific information

 
Line ID 821C08
Vector Used pAC106
Line Availability only available from NASC (N478752)
Segregation Analysis 50:12:10
Confirmed for Hit At1g74160
Parent of DUPLO pair 195
Parent of pair(s) none

Gene hit At1g74160

 
Sequence (A. th genome BLAST matches underlined)
>59-K025531-022-821-C08-8409
AACCAAAAACTGAGATGATCATGACTATGCCTACACTCGATCCTTGAATAACAATTAGCT
GTCCAGCGCTCTCCATTATGCTCCAACCTCAGTATGGAATCCGCCCTATGATGAGACTTC
TCCGAGATGCAAAACCTCTCATTTTGGTATGACACCTCAATCAGATACGATATTCCCCGT
TGACCCGCCTCCATGCAAACACACTGATAGAAACCCAGTTTTGCAAAATCAAGCTAGCAT
GCCTGTGAAAGCGAAGCCGTATGAAGCACCTAATTTTCCTCCTACTGCGTATGGCATCCT
CCCTATAGTGAGAAGCCCTCTGGCTTCTCCGTATGGGATCCTCCCTATAGTGAGNNNNNN
NNNN
GenBank Accession CR360559 [GenBank]
Graphic View Graphic view of gene At1g74160
Predicted Position of Insertion Chr1:27888624 - go to primer design
BLAST e Value 4e-49
Hit Clone Code (BAC ID) F9E11
Hit Gene Code At1g74160 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation unknown protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR360558 [GenBank]


Last Updated on 07.07.2016 14:03