SimpleSearch - Line and FST details


Line specific information

 
Line ID 821F04
Vector Used pAC106
Line Availability available as T3 set from NASC (N478784)
Segregation Analysis 49:39:29
Confirmed for Hit At1g14520
Parent of DUPLO pair none
Parent of pair(s) 2145, 3833, 3852

Gene hit At1g14520

 
Sequence (A. th genome BLAST matches underlined) 
>30-K025531-022-821-F04-8409
GGCCGCGACCCCGAGAATGTGTTAATGTCTTGGGGACATGATGATTACACGTATGGGATC
CTCCCTATAGTGAG
GenBank Accession CR360591 [GenBank]
Graphic View Graphic view of gene At1g14520
Predicted Position of Insertion Chr1:4969012 - go to primer design
BLAST e Value 2e-10
Hit Clone Code (BAC ID) F14L17
Hit Gene Code At1g14520 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myo-inositol oxygenase 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR360590 [GenBank]


Last Updated on 10.06.2021 13:37