SimpleSearch - Line and FST details


Line specific information

 
Line ID 823F09
Vector Used pAC106
Line Availability only available from NASC (N478981)
Segregation Analysis 50:50:50
Confirmed for Hit At5g19220
Parent of DUPLO pair none
Parent of pair(s) 1920, 3877, 4149, 4204

Gene hit At5g19220

 
Sequence (A. th genome BLAST matches underlined)
>70-K025529-022-823-F09-8409
NNNNCCGTCAGTATTCGGACATGAGCCATTTACATTGAATATATCCTGATTATCTGTTGT
GAGTGTTTCTCCTATAGTTTATGAACAGATCCAGAGACCTTAGGCATAAATTTGTTTATA
CTAATTTTGTCTACCAGCAGACCGCTCTGACTGAATTTTTAATCTTACTAACTGAAACCA
AGTATTATGATTCTAAAAGAATCCTAGTTTACAATATAGATCGACAGTAAATGAATATAA
AAGTCTGGTAGTATGGAATCCTCCGCATAATGAGCTTATATCCGCGCCACTCTGCCGATG
ATCCTGCAGATTGAAGTTCATGGCATGAGTCTCGGAGAGTAACTACCTCTTGATGAAGGA
CATGAGCTCAAGTAATTTTGTCTCACCTGTATAAAATCCATGTAATCCATCCTGTAGAGG
TGATCTCCAGAAAGGATCAATACATCCTCTATGTCCTTGCTTCTTGCATCCTATGAAAAG
AATGTTGGACCGCTTGTCTATTGATGTGATGATAAGCTAGTTTAAGTCTGATTTCTACCT
CGAAA
GenBank Accession CR360833 [GenBank]
Graphic View Graphic view of gene At5g19220
Predicted Position of Insertion Chr5:6465415 - go to primer design
BLAST e Value 2e-152
Hit Clone Code (BAC ID) T24G5
Hit Gene Code At5g19220 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ADP glucose pyrophosphorylase large subunit 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03