SimpleSearch - Line and FST details


Line specific information

 
Line ID 826F10
Vector Used pAC106
Line Availability only available from NASC (N479270)
Segregation Analysis 50:47:46
Confirmed for Hit At4g15500
Parent of DUPLO pair none
Parent of pair(s) 9710, 11152, 97582

Gene hit At4g15500

 
Sequence (A. th genome BLAST matches underlined)
>78-K025503-022-826-F10-8409
GAAGAAGCCATTACATTGAATATAGCCCGATAGTTCTAACCGAAGGCGGGAAACGACAAT
CTGATCCCCGGGTATGGGATCCTCCCTATAGTGAGCCACCAGTTANTTAAGTTTCCGACC
GAAACCGAGCCGGAAATAACCGTTGACGTCCCTTTCAAGCCATTAACATTGAAGCATGAC
GAGATCCCTAGCTTTCTTCACCCTTCCTCTCCGCTGTCCTCTATAGGAGGTATGGGATCC
TCCCTATAGTGAGGNNNTTNNTTNTNNNNTTTTTTGTNTNTTTTTTTTTTTTTTTTTTTT
NTTTTTTNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTN
NTTTTTTNTTTTNNTTTTTTTGTGTTGTGTGTGGGGTGTGTTGTGTTGTGTGGGGGGTGG
GGGGTGGTTGTGGTGTGTGTTTGATTTATGTGTGGTTTGGGTAGTTTATTATAGTTGAAT
TGGAAATATATTAGAAATA
GenBank Accession CR361151 [GenBank]
Graphic View Graphic view of gene At4g15500
Predicted Position of Insertion Chr4:8858118 - go to primer design
BLAST e Value 5e-70
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g15500 [TAIR] [MIPS] [SIGnAL]
Gene Annotation UDP-Glycosyltransferase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit T20D1

 
Sequence (A. th genome BLAST matches underlined)
>78-K025534-022-826-F10-8409
AACCGAAGGCGAGAAAAGGACAATCCGATCCCCGGGTACGTTATGCATGCTTACATTTCA
TGCTTGGTTTTCTATAACTTATGAAGACGCCCATATACAATGCTGTGTGCTATTGCTTTG
GAATAGCAAACTATGTATGGGATCCTCCCTATAATGAGTTCTTCACCCTTCCTCTCCGCT
GTCCTCTATAGGAGGTACGGGATCCTCCCTATAGTGAGNNNNTTTTTTTTTTTTNNNNTT
TGGGGGGNNNNNNNNTGNNGGGGGGGGNTNNNNGNNNTGGGGGNGGTGGTTNNTTTGTGG
GGGTGGGGGTGNGGTGGTGGTTGTGTGTGGTGGTGTGGAGNGGTTGGGTTTGTTTGTGTT
TGGTGGTTGGTNTGTGTTGGTTGGGGGGGGGGGGGTGTTTTTGTTTTTTTTTTTCCCCCC
CCCCGGTGTCTGTCTGGTTTTCTTTAAAAA
GenBank Accession CR361152 [GenBank]
Graphic View Graphic view of sequence CR361152 of line 826F10
Predicted Position of Insertion Chr5:6594853 - go to primer design
BLAST e Value 3e-31
Hit Clone Code (BAC ID) T20D1
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 14.10.2014 10:23