SimpleSearch - Line and FST details


Line specific information

 
Line ID 827D09
Vector Used pAC106
Line Availability available as T3 set from NASC (N479341)
Segregation Analysis 50:39:32
Confirmed for Hit At1g72970
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g72970

 
Sequence (A. th genome BLAST matches underlined) 
>68-K025720-022-827-D09-8409
AACACTAACGATCCAACAGAGCAACTATATTAATTACACCCACATGTGTCTCTATATATT
GTTACATATATGTAACCATTTCTACGAGTTGTATAACTTATAGTCTTATACGGTATGGGA
TCCTCCCTATAGTGAG
GenBank Accession CR399786 [GenBank]
Graphic View Graphic view of gene At1g72970
Predicted Position of Insertion Chr1:27452735 - go to primer design
BLAST e Value 1e-58
Hit Clone Code (BAC ID) F3N23
Hit Gene Code At1g72970 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Glucose-methanol-choline (GMC) oxidoreductase family protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR399785 [GenBank]


Last Updated on 10.06.2021 13:37