SimpleSearch - Line and FST details


Line specific information

 
Line ID 833A02
Vector Used pAC106
Line Availability only available from NASC (N479874)
Segregation Analysis 50:50:32
Confirmed for Hit At5g51930
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g51930

 
Sequence (A. th genome BLAST matches underlined)
>09-K025479-022-833-A02-8409
GTCTTGAGGCTCAGGATGTGAACCCACTCGTCCTAGATCAGCCCATGGTTGGGCAGGGGA
TGGCTGATAATCCCCTGAACTTTGTAGCCCTTCCTTCTCCTCCACCAGTAGAACTATCCC
TCATACCAGCTGTTGGGATCCCAAAGTTTGATAGTTACATTGAAGGTCCAAGTGGCTTGA
GTCTCTCTTTTGATATAACTCGTAGGTTTTTCGATGGTGTTTTGAATCTTTTAAACGAGG
TATATAACATAAATACATTTAAAGGTTATTTAGTTATGACTTATGAGATTGTATGTTGTC
TAACTATGACGCATTATGCAGACAAGTCATACTACATCTAGGAAAATCCTGACCCAATCC
ATTGCAGTCCTTTTAAAATCTTTTGATGTTAAATTGGAAGTGAGGATGAATGGGGGTTTG
ATCTTTCAAAAAGTCGATGGACCGGCCTCAAAAGGACATATGAAGCTACGGAACACGAAC
CCAAGGGATAATCCTTCAGTGA
GenBank Accession CR361178 [GenBank]
Graphic View Graphic view of gene At5g51930
Predicted Position of Insertion Chr5:21102688 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MJM18
Hit Gene Code At5g51930 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Glucose-methanol-choline (GMC) oxidoreductase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR361177 [GenBank]


Last Updated on 07.07.2016 14:03