SimpleSearch - Line and FST details


Line specific information

 
Line ID 833C07
Vector Used pAC106
Line Availability only available from NASC (N479903)
Segregation Analysis 50:37:24
Confirmed for Hit At1g51600
Parent of DUPLO pair 2314
Parent of pair(s) none

Gene hit At1g51600

 
Sequence (A. th genome BLAST matches underlined)
>51-K025473-022-833-C07-8409
AAGTATTTTCAGTATTGTATGGGATCCTCCCTATAGTGAGACGTATGAGACCCCCCCTGC
TTCGGATACTCATTGCCGATCCATGAAGCCACCTGGACTTATGTGGGCAAACAAGGCAAG
ACAATACTTGCTTCTTAATTTGATCAACTCTCTTTATCTTGCTCATTTTGTAGCACTAGT
GATTCGATGATTAGTCTGTCTAAATGAGGACGACATTTATACTTTCAGGGTGCTTTTAGG
GACTTATCCAAAGCCTCTCCTCAAACAGCCCAGAATCTTCCTTTAAATAAGAATGAAGTA
AGCAACATCATGTTTTGACCAAACAATTTGTTGTATGGGATCCTCCCTATAGTGAG
GenBank Accession CR361213 [GenBank]
Graphic View Graphic view of gene At1g51600
Predicted Position of Insertion Chr1:19134811 - go to primer design
BLAST e Value 2e-134
Hit Clone Code (BAC ID) F5D21
Hit Gene Code At1g51600 [TAIR] [MIPS] [SIGnAL]
Gene Annotation ZIM-LIKE 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23