SimpleSearch - Line and FST details


Line specific information

 
Line ID 836G11
Vector Used pAC106
Line Availability only available from NASC (N480243)
Segregation Analysis 50:43:30
Confirmed for Hit At5g02470
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g02470

 
Sequence (A. th genome BLAST matches underlined)
>34-K033039-022-836-G11C-3144
CCTTCGCAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACAGGGTACC
CGGGGATCAGATTGTCGTTTCCCGCCTTCGGTTTAAACTATAAGCAGCCTTCTTTTGCAC
ACTGCTCATAACTTTATTACGATCCATCTGCAAATAGAGGTAGAGAGATTAGTAGAGAAG
ACGAAGAGAGAGAGCAATTACATAGATGAGATAACTGAAAGGAAAAGCTTGGAAGCTAAA
CCTTGACTTCTTCCACATCCTTTTTGCAGGTAATAGGAAGTCCTTTCCACCGGATTTCCT
TTTTATCCCTTGCAATAATATCCAACGCCATGAACACATTGAGCGCATCGTAGACTCTCC
GCCTTATGTTCTTCTCATTGTACTGATTGAACATAAGAGAATGTTGTTATAGCTTTTTTT
TTTTCCAAATAACTCAAGACAGATGATATGAGCTTTCCATCTCGCTATACCTCATTTTCA
TTCAAAGGCTTCTCTGCGTTTTGCTTAATTGGGGCAAAATCTGAAATAATTTCGTCTGCA
ACCTGGAATCACAAGAGCCACAGTC
GenBank Accession HG969152 [GenBank]
Graphic View Graphic view of gene At5g02470
Predicted Position of Insertion Chr5:543349 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T1E22
Hit Gene Code At5g02470 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Transcription factor DP
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR400561 [GenBank] HG969152 [GenBank]


Last Updated on 31.08.2016 09:40