SimpleSearch - Line and FST details


Line specific information

 
Line ID 839C02
Vector Used pAC106
Line Availability only available from NASC (N480474)
Segregation Analysis 50:47:35
Confirmed for Hit At1g19940
Parent of DUPLO pair none
Parent of pair(s) 3172, 91136, 91178, 91207, 91221, 91242

Gene hit At1g19940

 
Sequence (A. th genome BLAST matches underlined)
>11-K025536-022-839-C02-8409
GNAGCCATTTACATTGAATATATCCTGCAGAGACAGCAGCAGCTATGGCTGCAGCATCTT
TAGTCTTTAAAGAAAGTGATACCAAGTATTCAAGCACGCTTTTGAAACATGCGAAGCAGT
TGTTCGATTTTGCGGATAATAACAGAGGATCTTACAGTGTTAATATACCTGAGGTTCAGT
CTTATTATAACTCAACTGGTTATGGAGATGAGCTTCTTTGGGCAGCTTCATGGTCGTATG
GGATCCTCCCTATAGTGAG
GenBank Accession CR361453 [GenBank]
Graphic View Graphic view of gene At1g19940
Predicted Position of Insertion Chr1:6919542 - go to primer design
BLAST e Value 2e-115
Hit Clone Code (BAC ID) F6F9
Hit Gene Code At1g19940 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation glycosyl hydrolase 9B5
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR361452 [GenBank]


Last Updated on 31.08.2016 09:40