SimpleSearch - Line and FST details


Line specific information

 
Line ID 840D06
Vector Used pAC106
Line Availability only available from NASC (N480586)
Segregation Analysis N/A (line seemingly not resistant, T2 plants grown without drug)
Confirmed for Hit At5g46580
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g46580

 
Sequence (A. th genome BLAST matches underlined)
>16-K104847-0022-840-D06C-3144
CCTTGCAGACCCTTCCTCTGTATAGGAAGTTCATTTCATTTGCAGAGGACAGGGTACCCG
GGGATCAGATTGTCGTTTCCCGCCTTCGGTTTAAACTATCAGTGTTTGAGGAAACAGACT
CTTGGATTTAACCCAATTAAAGAAAGTATGAGTCTTTTGCCATTCTCTTAAGCTGTTTAG
CACAAGCAATGCGTTATCTCTATTGGGTGGATGAGGAATCTCATCGAGAAGAGATAAAAA
CTCAGACTTTTCAGTGAAAATAGAACTATTGAGCTTCAGAGCAAAAGCCCTAAGATCCTT
GATTTGAGGATTGTAAGAGTAAGCAGAACGCTTTTGTCTCTGAAGTGAAAGAACTGACCT
TTTGGGTCTTGTTGGATTGACCCAGACAGATTTCGGTTTAGACAAGATTTGAGTTTGCTC
TTGTCTGAGTGTTGAAAC
GenBank Accession HG969153 [GenBank]
Graphic View Graphic view of gene At5g46580
Predicted Position of Insertion Chr5:18899097 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F10E10
Hit Gene Code At5g46580 [TAIR] [MIPS] [SIGnAL]
Gene Annotation pentatricopeptide (PPR) repeat-containing protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR400830 [GenBank]


Last Updated on 14.10.2014 10:23