SimpleSearch - Line and FST details


Line specific information

 
Line ID 840G03
Vector Used pAC106
Line Availability only available from NASC (N480619)
Segregation Analysis 50:43:33
Confirmed for Hit At2g41670
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g41670

 
Sequence (A. th genome BLAST matches underlined)
>23-K025828-022-840-G03-8409
ATATATCCTGCGCATTGAAAAGTTACCTTCTTTGCATAATTTTTCGTATGTAGCTGCTTG
ATCTCGTGGAGTTGAAGCTCAAAGAAGTGATTGCTACGGAGCCTACTTTACTTGTAATGG
TGGTTGGTGTCCCCAATGTTGGAAAATCTGCGCTCATTAACTCGATCCATCAAATTGCAG
CAGCTCGTTTTCCGGATAAAATATTGGTGTCTCAGCTTATCACCAGTGTTGAGTATGGGA
TCCTCCCTATAATGAGATGCAAGCATGGCATCCACCTGAAAGAGCGACTAAAAGAAATGG
TATTATACTACAAACAAATATAGATGAAAAAAGTATAATAATAACTA
GenBank Accession CR400869 [GenBank]
Graphic View Graphic view of gene At2g41670
Predicted Position of Insertion Chr2:17374759 - go to primer design
BLAST e Value 1e-116
Hit Clone Code (BAC ID) T32G6
Hit Gene Code At2g41670 [TAIR] [MIPS] [SIGnAL]
Gene Annotation P-loop containing nucleoside triphosphate hydrolases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23