SimpleSearch - Line and FST details


Line specific information

 
Line ID 844C07
Vector Used pAC106
Line Availability only available from NASC (N480959)
Segregation Analysis 50:45:42
Confirmed for Hit At1g01720
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g01720

 
Sequence (A. th genome BLAST matches underlined)
>51-K025742-022-844-C07-8409
NNNTTCGTCGTTATTCCGGACATAAGCCATTTACAATTGAATATATCCTGTCGCCGATGC
CGCTTATCACCCCTTGCTACTCGTCATGTTGCTTTATACACAGATGGGATCCCTGTTATT
CAAACCATTATCAATGGTATTGGTATTGTGATTACCTTCCCCCCAACAATCTGTGCAATT
GGGCTACCTATGAATCTCGCGCGGAATTTTCAGATACACCGCCTGATGCAAGCTACTCAA
ATCCATACTATGCAGCTTCAGCACCGAATCCGACGTGTCGAAATACACAAAATCACTTGT
CAGTTGAGCCGGCGTATGCAATCCCCTCTCCGTCGCCTTCGGCTTCTCCTCCATGATTTC
GTCGCCGTAAACAACCGGAGGCGGTGGTCCCCGCCTCTATGAAACTCCTTTTTTGTTAAA
AATACGGGAGAAAACCCAATCCTCTCACAAGCAAAAAATCGCAATTTGTCATTCATTTTA
CCGGAAGCCTACCAAGACATTTCAACGATAATGTGACTTCCATTCATCCCCATACTCTGA
TACTATTCTTCTACTTGCCAACG
GenBank Accession CR401245 [GenBank]
Graphic View Graphic view of gene At1g01720
Predicted Position of Insertion Chr1:269295 - go to primer design
BLAST e Value 2e-51
Hit Clone Code (BAC ID) T1N6
Hit Gene Code At1g01720 [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAC (No Apical Meristem) domain transcriptional regulator superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23