SimpleSearch - Line and FST details


Line specific information

 
Line ID 845F03
Vector Used pAC106
Line Availability only available from NASC (N481087)
Segregation Analysis 50:49:40
Confirmed for Hit At5g59670
Parent of DUPLO pair none
Parent of pair(s) 6748, 10753, 10754, 72895, 72962, 72996, 73025, 73115, 73140, 73169, 73195, 73221, 73242, 73264, 73313, 73335, 73354, 73415, 73434, 73465, 73491, 73504, 73514, 73535, 73545, 73554, 73568, 73574, 73579, 73580, 73581, 73582, 73583

Gene hit At5g59670

 
Sequence (A. th genome BLAST matches underlined)
>22-K025830-022-845-F03-8409
GAAGCCATTTACAATTGAATATATCATAGCACTGATAGTATTAAACCGAAGGCGGGAAAC
GACAATCTGATCCCCGGAGTAGGGATCCTCCCTAGTGTGAGCTTCCAAAGCATTAAGTAG
AGGTGGAAGAGTTGATCTTTTGGTTCTTATCAGCTGAAAATTACATGCCCATCCATTGCA
ACTTATCGGTGACGAGCTTTGGAAGGTCTTTATACTTAGCTTATCTGGGACTTCAGGGCC
AGTCACAGATAAATTTTGTCCATTCAATAAGATGTTGAATTCTCTGGTATCATTTGCCTG
CAAGTCTTGGATCTCAGCATAGTGTGCGTAAAAGTAATATTGGACATCCAATTTTTCTGA
ATTCCATTTAAATGTCAGTGGCGCACTAGCATCAGTAGGCGTGGCAGCATTTTTCAGCGC
ATCTTCCGGTGGTTGATAAATGTTGGTATTAATCACCCCGAGAGCAGTGGATATCTGGGT
CCATTCGTCCATGAAGCGCGGAAACCCTGAGCGATTCATACCATCTTTACCGTATG
GenBank Accession CR401419 [GenBank]
Graphic View Graphic view of gene At5g59670
Predicted Position of Insertion Chr5:24043043 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MTH12
Hit Gene Code At5g59670 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Leucine-rich repeat protein kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR401418 [GenBank]


Last Updated on 14.10.2014 10:23