SimpleSearch - Line and FST details


Line specific information

 
Line ID 846C05
Vector Used pAC106
Line Availability available as T3 set from NASC (N481149)
Segregation Analysis 50:36:27
Confirmed for Hit At3g17730
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g17730

 
Sequence (A. th genome BLAST matches underlined)
>35-K025831-022-846-C05-8409
AGCATTTACATTGAATATAATATGATATGAACTGATTTTTAGTTGTTGTGATCGATAAAT
AAAACTGTAGAGAAGTCGTTTCTACCAAGTAGAGATCCGGAGTGGTATTTTTTTGGGCCA
CGTGACCGGAAGTATCCGAACGGGTTTAGGACGAACCGAGCAACGAGAGGTGGGTATGGG
ATCCTCCCTATAGTGAG
GenBank Accession CR401483 [GenBank]
Graphic View Graphic view of gene At3g17730
Predicted Position of Insertion Chr3:6064624 - go to primer design
BLAST e Value 2e-69
Hit Clone Code (BAC ID) MIG5
Hit Gene Code At3g17730 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAC domain containing protein 57
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37